The Alexander Silberman Institute of Life Sciences
Home
òáøéú
The Center for Genomic Technologies : DNA Sequencing

 
The Technology:
The method of automated DNA Sequencing, utilizes the BigDye Terminator cycle sequencing chemistry from Applied Biosystems (ABI), ABI PRISM 3730xl DNA Analyzer and the ABI’s Data collection and Sequence Analysis softwares.

Download software:
For viewing and printing sample files containing the sequencing data as a electropherogram or text file

Sample submission:
When submitting your DNA samples, always enclose the following:
1.     DNA sample 
2.     Primers 
       (type the details to prevent reading errors)
DNA samples and primers should be submitted only in tubes of 1.5 ml or full plates of 96 samples.
Write you name and name of DNA/primer on the tube's cap.

Sequence data is manually edited and sent to the customer in a .ab1 and .seq format via E-mail. Other options are available upon request. Please keep the name of your sample that is given by the software. For example;
 
Run number
Lane number
two first characters of customer's name
DNA ID
Primer ID
Name of file
Type of file
s1287_
05_
mi-
pgem-
T7
.ab1.seq
text
s1287_
05_
mi-
pgem-
T7
.ab1
electropherogram
 
DNA samples  -             10µl per reaction:
Plasmid                         75-300 ng/µl
PCR fragment                 5-50 ng/µl
BAC or Cosmid               200-1000 ng/µl
DNA requirements:
All samples should be dissolved in double distilled water (DDW)
Spectrophotometric absorbance parameters of your sample should be:
260/280 = 1.8-2.0
260/230 = 1.8-2.0 
Difficult Templates
If you are having trouble with difficult templates, such as those with high G+C content, homopolymer regions, secondary structures or siRNA and our standard reaction cannot solve the problem, we can run the reaction with 5% DMSO and Betaine. However, we cannot always sequence these regions effectively. Please mark the right column on the submission form
 
Host Strain
1. The host strain used for your plasmid can affect the sequence quality of the resulting DNA.
2. Hosts that consistently work well: HB101, DH5a.
3. Hosts that have demonstrated some variability: MV1190, XL1 Blue, JM109.
4. Grow more slowly than most strains, resulting in lower DNA yields.
5. Do not respond to TB growth medium, unlike other strains.
6. Hosts that do not work well: JM101.     
 
Primers
If standard primers (for plasmid analysis) are to be used (see below), primer’s name will suffice. In more specialized analyses, please submit your own primers.
 
Internal primers submitted by the customer should be:
10µl per reaction, of 2 pmoles/µl (2µM), in DDW.
18-22 bases with 50-60% GC content. Melting point (Tm)= 50-600C. 
Degenerate primers should be 50 pmoles/µl
 
 
Standard Primers available at the DNA sequencing facility:
 
Primer name                     Primer sequence
--------------------------------------------------------------------------
T7                                   TAATACGACTCACTATAGGG
 
T3                                   AATTAACCCTCACTAAAGGG
 
M13-(-20) forward             TGTAAAACGACGGCCAGT
 
M13-Reverse                   GGAAACAGCTATGACCATG
 
SP6-19mer                      GATTTAGGTGACACTATAG
 
SP6-20mer                      CCAAGCTATTTAGGTGACAC
 
SP6-18mer                      ATTTAGGTGACACTATAG
 
PolyT                              TTTTTTTTTTTTTTT /A /G /C
 
SK                                  CGCTCTAGAACTAGTGGATC
 
KS                                  TCGAGGTCGACGGTATC
 
pGEX 5':                          5' - GGG CTG GCA AGC CAC GTT TGG TG - 3'
 
pGEX 3':                          5' - CCG GGA GCT GCA TGT GTC AGA GG - 3'
 
T7term:                            5' - GCT AGT TAT TGC TCA GCG G - 3'

             
                                                                              
                                                                
                         
 
Advanced Search


 
 
Faculty of Science The Hebrew University of Jerusalem The Hebrew University of Jerusalem