The National Center for Genomic Technologies

The Center for Genomic Technologies of The Hebrew University of Jerusalem is a Core facility and Service Laboratory dedicated to various approaches for detecting nucleic acid variations. The Center is equipped with the most advanced technologies and often implements new technologies as they become available, keeping the standards of an innovative and up-to-date center. The Center’s staff is professional and knowledgeable assuring utilizing the complex advanced systems in the optimal manner
The center offers nucleic acid analysis services for research goals, to the academic, healthcare, industrial and environmental research communities. With highest service standards and customers oriented approach, a reliable and efficient service is guaranteed. 
Some of the technologies are also open for self-usage of university researchers and students after verified guidance and upon registration. 
 
E-mail Phone Fax Office
Dr. Michal Bronstein
Head of Core Facility
02-65-84048 Silberman -3XX
Ms. Ida Giguzin
Core Facility Staff
02-65-84877 Silberman 1-3XX
Ms. Marina Mordechaishvili
Core Facility Staff
02-65-84877 Silberman 1-3XX
Ms. Meira Shlepakov
Core Facility Staff
02-65-85640 Silberman 1-3XX
Ms. Adi Turjeman
Core Facility Staff
02-65-85640 Silberman 1-3XX
Prof. Sagiv Shifman Prof. Sagiv Shifman
Academic Director
02-65-85396 02-6586975 Silberman 2-317

Standard Sequencing

The Technology

The method of automated DNA Sequencing, utilizes the BigDye Terminator cycle sequencing chemistry from Applied Biosystems (ABI). The samples are sequenced by the 96-capillary 3730xl DNA Analyzer with ABI’s Data collection and Sequence Analysis software.

Free software for viewing the sequencing data – “Sequence Scanner 2” (http://resource.thermofisher.com/page/WE28396_2/)

 

The following DNA sequencing services are offered:

  • Full price Sequencing:

Customers submit samples and primers separately.

Samples in Eppendorf tubes (so we can measure the template concentration) or arranged in strips or plates (mostly for PCR products cleaned by ExoSAP ). Sequencing can be done with in-house DNA sequencing primers or specific sequencing primers provided by the customer.

In this option we will mix DNA, primer, and sequencing reagents, perform the cycling reaction, purify, sequence, analyze, check the outcome and repeat the sequence in case of obvious problem or according to customer request. Customers will receive via email the complete unedited/edited sequence, as will be agreed with each customer.

  • Reduced price Sequencing:

Customers submit a mixture of template and primer already “Ready-To-Go” (RTG).

We will mix with the sequencing reagents, perform the cycling reaction, purify, sequence, and analyze the samples. Customers will receive the complete unedited sequence. In this option we will not check the outcome and will not repeat.

  • Run-only Sequencing :

Customers submit sequencing plates that are ready to be loaded to on the ABI 3730XL. We will sequence and analyze the samples. Customers will receive the complete unedited sequence via email. In this option we will not check the outcome and will not repeat.

 

Sample submission

All samples should be submitted with Sample Submission Form for DNA Sequencing.

Write the submitter’s name and the name of DNA/primer on the cap of each tube.

 

DNA requirements:

Volume: 10µl per reaction

Concentration:

Plasmid

75-300 ng/µl

PCR fragment                 

5-50 ng/µl

BAC or Cosmid              

200-1000 ng/µl

All samples should be dissolved in double distilled water (DDW)

 

Difficult Templates

If you are having trouble with difficult templates, such as those with high G+C content, homopolymer regions, secondary structures or siRNA and our standard reaction cannot solve the problem, we can run the reaction with 5% DMSO and Betaine. However, we cannot always sequence these regions effectively. Please mark the right column on the submission form.

 

Primers requirements:

Volume: 10µl per reaction

Concentration: 2 pmoles/µl (2µM)

Primers should be dissolved in double distilled water (DDW).

18-22 bases with 50-60% GC content. Melting point (Tm)= 50-60°C. 

Degenerate primers should be 50 pmoles/µl

 

Standard Primers available at the DNA sequencing facility:

Primer name                    

Primer sequence

 

T7

TAATACGACTCACTATAGGG

T3  

AATTAACCCTCACTAAAGGG

M13-(-20) forward 

TGTAAAACGACGGCCAGT

M13-Reverse                  

GGAAACAGCTATGACCATG

SP6-18mer                     

ATTTAGGTGACACTATAG

PolyT

TTTTTTTTTTTTTTT /A /G /C

pGEX 5'

5' - GGG CTG GCA AGC CAC GTT TGG TG - 3'

pGEX 3'

5' - CCG GGA GCT GCA TGT GTC AGA GG - 3'

T7term

5' - GCT AGT TAT TGC TCA GCG G - 3'

 

Instruction for Ready-To-Go mix preparation

RTG-mix should be submitted as 30 ul mixture in tubes/strips/ plates.

In the submission form, RTG-mix should be indicated in the Remarks section.

For more than 8 samples, submission form should be sent both by mail and as printed version.

Please note to list the order of samples in RTG plate by columns (A1 B1 C1 D1 E1 F1 G1 H1 A2 B2 …)

Concentration of template and primers should be adjusted according to the table below.

Type of DNA

DNA

Primer

DNA amount

Final concentration

Primer amount

Final concentration

DS Plasmid DNA

440ng/30μl

14.7ng/μl

9pmol/30μl

0.3μM

PCR Fragments 100-200bp

12ng/30μl

0.4ng/μl

9pmol/30μl

0.3μM

PCR Fragments 200-500bp

24ng/30μl

0.8ng/μl

9pmol/30μl

0.3μM

PCR Fragments 500-1000bp

45ng/30μl

1.5ng/μl

9pmol/30μl

0.3μM

PCR Fragments 1000-1500bp

66ng/30μl

2.2ng/μl

9pmol/30μl

0.3μM

PCR Fragments 1500-2000bp

90ng/30μl

3.0ng/μl

9pmol/30μl

0.3μM

PCR Fragments > 2000bp

110ng/30μl

3.7ng/μl

9pmol/30μl

0.3μM

Exo-Sap treated PCR mix

1ul of mix

 

9pmol/30μl

0.3μM

BAC DNA

3.7μg/30μl

125ng/μl

24pmol/30μl

0.8μM

 

Results

Sequence data is sent to the customer in both XXX.ab1 and XXX.seq format via E-mail.

Please note the name given by the software to the samples, and the meaning of its parts:

It includes the number of the run, the position of the sample in the sequencing plate, 2 digits of the sender’s name, and the temples and primers designations, as filled in the submission form.

 

For example:

s1287_05_mi-pgem-T7.ab1.seq

 Run number

well number

Two first characters of customer's name

DNA ID

Primer ID

Type of file

s1287_

05_

mi-

pgem-

T7

.seq

 

 

 

 

Single Gene or Exon Sequencing

The Center of Genomic Technologies - Single gene or Exon sequencing

Library Preparation

Library construction:

We provide full Library construction and sequencing service for NGS, starting at whatever stage required, according to customer’s needs.

When planning a new NGS project we suggest researchers to start with consulting with us. Our team together with a bioinformatics advisor has a reputation of providing expert, personalized service from the first stages of experimental design, choice of library preparation method and sequencing parameters.

Our experienced stuff have years of experience with most of the commercial kits available on the market. Some commercial kits are in standard usage and in stock in our lab and can be ordered in any numbers upon request. Other commercial kits can be ordered by customers and sent to our lab together with the samples for efficient and reliable handling. Service for homemade protocols is also available, if a detailed manual is provided.

Our in-house stock Libraries:

               TruSeq kit of Illumina

                 https://www.illumina.com/products/by-type/sequencing-kits/library-prep-kits/truseq-rna-v2.html

Instruction for samples delivery:

The minimal RNA amount for library generation is 100ng dilute in 52ul.

The maximal RNA amount for library generation is 2ug dilute in 52ul.

Samples should be delivered in strips only marked in chronological numbers.

In the submission form , fill the table with your sample name respectively to the chronological numbers marked on the strip.  

 

               Sense kit of lexogen

               https://www.lexogen.com/sense-mrna-sequencing/

Instruction for samples delivery:

The minimal RNA amount for library generation is 500ng dilute in 52ul.

The maximal RNA amount for library generation is 2ug dilute in 52ul.

Samples should be delivered in strips only marked in chronological numbers.

In the submission form , fill the table with your sample name respectively to the chronological numbers marked on the strip.  

 

NEBNext Multiplex Small RNA Library prep kit of New England

https://international.neb.com/products/e7300-nebnext-multiplex-small-rna-library-prep-set-for-illumina-set-1#Protocols%20&%20Manuals

Instruction for samples delivery:

The minimal RNA amount for library generation is 100ng dilute in 7ul.

The maximal RNA amount for library generation is 1ug dilute in 7ul.

Samples should be delivered in strips only marked in chronological numbers.

In the submission formלצרף לינק לטופס הגשת דוגמאות , fill the table with your sample name respectively to the chronological numbers marked on the strip.  

    

Nextera kit of Illumina

https://www.illumina.com/products/by-type/sequencing-kits/library-prep-kits/nextera-dna.html

Instruction for samples delivery:

Samples should be 1-10ng dilute in 20ul.

Samples should be delivered in strips only, marked in chronological numbers.

In the submission formלצרף לינק לטופס הגשת דוגמאות , fill the table with your sample’s name according to its chronological numbers as marked on the strip.  

 

 

 

        

 

Sequencing Service

Sequencing technologies:
 
We have in house Illumina’s NextSeq and Miseq sequencers.
 
NextSeq 500
Suitable for sequencing of fragments of 30-300bp long
Output of 130-400M reads per lane 
 
The various Kits available for sequencing are described in the links-
 
Miseq
Suitable for sequencing of fragments of 30-600bp long
Output of 1-24M reads per lane 
 
The various Kits available for sequencing are described in the links-
 
Sequencing services:
We sequence our locally constructed libraries as well as libraries prepared by others that are sent to our facility.
We also provide a unique service of combining libraries of different users on a common run enabling a significant reduction of sequencing costs.
Samples should be delivered as a 4nM pool in 20ul with the submission form .
 

Expression Analysis & RNA Profiling

The Center bases its work on the following instruments:

Affymetrix Software in the Center:

Affymetrix® GeneChip® Command Console® Software (AGCC)  summarizes probe cell intensity data (.CEL file generation).

Available applications:

Complete list of applications and arrays (https://www.thermofisher.com/il/en/home/life-science/microarray-analysis.html)

 

For details please contact the local Affymetrix Product manager:

Amos Grundwag, Eisenberg Bros. Ltd.,

Tel: 972-3-9777037, Mobile: 972-52-8910960,

E-Mail: amosg@eisenbros.co.il

 

Sample submission:

 All samples should be submitted with Sample Submission Form for Affymetrix Microarrays.

 

RNA/DNA requirements:

RNA

For Eukaryotic Expression assay: 50-500ng (concentration > 50ng/μl)

For Prokaryotic Expression assay: 10-13μg (concentration >500ng/μl)

For Whole Transcript Sense Target assay: 300ng (concentration > 100ng/μl)

For miRNA assay: 0.2-3μg (concentration > 125ng/μl)

 

Ratio 260/280=1.8-2.0 

RIN (RNA Integrity Number)>7 is acceptable

  

DNA

For CytoScan assay: >300ng (concentration > 50ng/μl)

 

SNP Genotyping & Copy Number Variation

The Center of Genomic Technologies - SNP Genotyping and Copy number variation

Real Time PCR Technologies

All Real-Time PCR technology projects can be done with Good Laboratory Practice (GLP) standard.

The Center bases its work on the following instruments:

The available applications:

Consumables and Disposables

  • ABI PrismTM 96-well Optical Reaction Plates sealed with Optical Adhesive Covers
  • ABI PrismTM 384-well Optical Reaction Plates sealed with Optical Adhesive Covers
  • Micro Fluidic Cards

Real-Time PCR using the SYBR Green or TaqMAN:

There are three options:

  1. Running a 96-wells PCR plate, the assay is done by the customer.
  2. RNA samples are submitted. RT-PCR amplifications and Real-Time PCR are performed at the Center, with primers provided by the customer.
  3. cDNA samples are submitted. Real-Time PCR is performed at the Center, with primers provided by the customer.

Requirements for Primers (SYBR-GREEN chemistry)

  • From 30 to 80% G/C content.
  • Melting temperature (Tm) from 58 to 60°C.
  • The five nucleotides at the 3´ end of primer should have no more than two G or C bases.
  • Recommended primer concentration 50nM.  
  • Length of amplicons should be in 50-150 basepairs range.

Requirements for Primers and Probe (TaqMAN chemistry)

  • Primers and probe with 30 to 80% G/C content
  • Melting temperature (Tm) for the primers 58 to 60°C, Tm for the probe 8 to 10°C higher.
  • Do not select probes with G on the 5´ end.
  • The five nucleotides at the 3´ end of primer should have no more than two G or C bases.
  • Recommended primer concentration 900nM and probe concentration 250nM.
  • Amplicons are in the 50- to 150-basepairs range.

Microfluidic card (Low Density Microarray)

Real-Time PCR is performed at the Center, with card provided by the customer.

cDNA samples are submitted.

Concentration of cDNA between 25-50 ng/µl.

Amount of cDNA 100 ng/port (48 reaction chambers)

Always include Sample submission form for Cards.    

SNP (Single Nucleotide Polymorphism) detection using the TaqMAN Probe

SNP Assays provided by the customer.

Genomic DNA samples are submitted

The DNA concentration should be 10-20 ng/µl.

The volume of the samples depends on the number of requested SNPs but not less than 20 µl.

DNA samples should arrive in a 96-wells plate even if the plate is not full.

The order of the samples in the plate should always be as follows:

          Sample 1 is in position A1

          Sample 2 is in position B1

          .....................................

          Sample 96 is in position H12

High-throughput (96x96) RT PCR on Fluidigm BioMark.

Real-Time PCR is performed at the Center.

IFC-array provided by the customer.

For Gene Expression analysis the customer need to provide plate with cDNA samples and plate with diluted primers. The final concentration of Forward+Reverse primers should be 50µM.

 

Real Time Services

The Center of Genomic Technologies - Real time Services

Full Service

Fragment Analysis

The Center bases its work on the following instrument: 96-capillary 3730xl DNA Analyzer

Software:

  • GeneMapper® Software can be purchased through the local agent Rhenium (www.rhenium.co.il

  • Peak Scanner™ 2 Software can be free downloaded from here

Dye sets:

The two dye sets for detection and sizing labeled PCR product are available in the Center:

  • DS-30: Size standard ROX-400. PCR product should be <400bp and labeled with 6-FAMTM, HEXTM, NEDTM.

  • DS-33: Size standard LIZ-500. PCR product should be <500bp and labeled with 6-FAMTM, VICTM, NEDTM, PETTM.

Sample submission:

All samples should be submitted with Sample submission form for labeled PCR products

1. PCR is performed by customer

Labeled PCR amplification products are submitted.
PCR products should arrive in a 96-wells plate even if the plate is not full.
The order of the samples in the plate should always be as follows:

Sample 1 is in position A1
Sample 2 is in position B1

Sample 96 is in position H12

Samples should be diluted appropriately before submission.    
Table with names of the samples should be send by E-mail.

2. PCR is performed at the Center

  • DNA samples are submitted. Concentration of DNA >100ng/µl. The samples should arrive in 1.5ml tubes.
  • Primers should be provided by the customer. The concentration of the primers should exceed 10µM and be noted on the tube. 
 

Running Ready Plates

The Center of Genomic Technologies - Running ready plates

Iprep Station

The iPrep™ Purification Instrument (http://tools.thermofisher.com/downloads/B-066973-iPrep_Prfctn_FLR.pdf)

Throughput: 1-12 samples (plus one control) in less than 30 minutes or 192 samples per day.

Reagents: prefilled, sealed reagent cartridges that prevent cross-contamination of samples

Isolation: high quality RNA and DNA from different types of samples

Various Protocols

We routinely offer the following services:

  • RNA and DNA extraction from a variety of other sources up to large scale projects.
  • cDNA synthesis (with High-Capacity cDNA Reverse Transcription Kit).
  • Different DNA/RNA manipulations.

Method of RNA/DNA extraction depends on start material and aim of the project and should be discussed with us.

Costumer should provide all reagents for RNA/DNA extraction.

One of the nucleic acid purification option is using The iPrep™ Purification Instrument that is available in our facility.

 

• Bioanalyzer Analysis

We have two types of kits:

Nano-kit

Quantitative range 25–500 ng/µL

Qualitative range 5–500 ng/µL

Samples per chip-12

Sizing on the 25 – 4000 nt range

Pico-kit

Qualitative range 50–5000 pg/µL in water

Samples per chip-11

Sizing on the 25 – 4000 nt range

 

All other types of run, for example with Small RNA-kit, can be done with kit purchased by customer.

 

Sample submission

The RNA samples should arrive only after telephone appointment with the Center.

The samples should be in strips or in RNase free 1.5ml tubes. Keep them frozen all the way.

Sample Volume Required - 2 μL.

If you are planning to work with this sample in future, transfer 2 μL for bioanalyzer to the separate tube.

Always include Sample submission form form Bioanalyzer.

 

Tapestation Analysis

We use the following kit:

High Sensitivity D1000-kit

Sizing range 35 – 1000 bp

Concentration range 10 – 1000 pg/μL

Sensitivity 5 pg/μL

Sample submission

The samples should be in strips or in RNase free 1.5ml tubes.

Sample Volume Required - 2 μL.

Always include Sample submission form for Tapestation.

 

  Word PDF
DNA Sequencing
Bioanalyzer
RT-PCR 
Affymetrix Microarrays
 
MiSeq / NextSeq
Libraby Construction